Support searching NCBI for matching sequences

[mlluciano]

[External Email]
Hello,
I would like to report a possible bug on the iChatBio platform (chat.acis.ufl.edu). I tried using the chat by providing an NCBI sequence ( code in my query, but I received an error message :

"I understand your request, which is to identify the species from the provided ITS sequence. I tried to search for this sequence in the NCBI Nuccore database, but a technical error occurred during the search"

Unfortunately, the message did not explain the nature of the problem or how to resolve it, so I am not able to tell whether the issue comes from my input parameters or from the platform itself.​

Here is the sequence (ITS from a fungi collection) :

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGGATTTTAGAGGGTTGATGCTGGTAGTTTATCTACATGTGCCCACTCTTCTGATTTATTTACACCTGTGCACTTCATTTTTTTTCAAGGGTCAGGGTAGAACCTGCCTTTGGGACTTATAAGCCCCTAACCCCTATATTGGAACAATGGATGTTTATCTGCCGCAAGGCAAAATTTTTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCTCTGGTATTCCGGGGAGCACACCTGTTCGAGTGTCATTAAGACTCTCAAATAAAGGTGGCTCTTGCAGCCATCTCTGTTTGGACTTGGGCTTTGCTGCATTAATGTGGCTAGTCTTAAATCTATTAGCTGGTCCTTGTTGAGATTTTGGTTCTACTCAGTGTGATAATTATCTAGCATTGAGGACAGTCTCAGAACTGGCCATAGCTCTCTCTGGATTGCTTCTAAAAGTGTCTTGGGGACAATTGCTTAATTTCTGACCTCGAATCAGGTGGGACTACCCGCTGAACTT

[mlluciano]

This agent does not have the ability to identify species from raw sequences.

It can perform text searches to find sequence record IDs in NCBI'S Nucleotide database. Given a sequence record ID (e.g. a GenBAnk accession number, GI number, Nucleotide UID, etc.) it can download the associated sequence record as both human-friendly "flat file" and machine friendly JSON.

[mielliott]

Let’s make it a feature!