Dev 1.1.0

docs/how-to-guides.md

@@ -12,7 +12,7 @@ scheme = Scheme.from_file("./primer.bed")
 scheme = Scheme.from_str('# header!!!\nMN908947.3\t47\t78\tSARS-CoV-2_1_LEFT_1\t1\t+\tCTCTTGTAGATCTGTTCTCTAAACGAACTTT\nMN908947.3\t419\t447\tSARS-CoV-2_1_RIGHT_1\t1\t-\tAAAACGCCTTTTTCAACTTCTACTAAGC\n')
 
 # Headers 
-print(scheme.header)
+print(scheme.headers)
 ['# header!!!']
 
 # Bedlines 
@@ -58,10 +58,14 @@ print(bl.primername)
 
 # change the strand
 bl.strand = "-"
+# See Error
+ValueError: The new stand (-) is incompatible with current primer_class (LEFT). Please use method 'force_change' to update both.
+# Use correct
+bl.force_change("RIGHT", "-")
 print(bl.primername)
 'new-amp-name_1_RIGHT_1'
 
-# this also works in reverse 
+# this also works in reverse (without force_change)
 bl.primername = "final_10_LEFT_alt1"
 print(bl.amplicon_prefix, bl.amplicon_number, bl.strand, bl.primer_suffix, sep= " | " )
 "final | 10 | + | alt1"
@@ -218,4 +222,36 @@ group_by_class(bedlines)
 # For each amplicon. It will return ([f bedlines], [r bedlines])
 group_primer_pairs(bedlines)
 [([<primalbedtools.bedfiles.BedLine object at 0x105431650>], [<primalbedtools.bedfiles.BedLine object at 0x105431fd0>, <primalbedtools.bedfiles.BedLine object at 0x105432850>]), ([<primalbedtools.bedfiles.BedLine object at 0x105432150>], [<primalbedtools.bedfiles.BedLine object at 0x105432650>])]
-```
+```
+
+### Export as CSV
+
+While not a typical use case there will be times when primer.bed files need to be parsed by system out of our control, for example LIMs or Liquid handers. Therefore, all data contained in the bedfile can be exported to a CSV.
+
+A header row is written by default, containing all bedline information + parsed and separated Attributes.
+
+```
+# gc=fractiongc
+MN908947.3      100     131     example_1_LEFT_1        1       +       CTCTTGTAGATCTGTTCTCTAAACGAACTTT pw=1.4;gc=0.35
+MN908947.3      419     447     example_1_RIGHT_1       1       -       AAAACGCCTTTTTCAACTTCTACTAAGC    pw=1.4;gc=0.36
+MN908947.3      344     366     example_2_LEFT_1        2       +       TCGTACGTGGCTTTGGAGACTC  pw=1.0;gc=0.55
+MN908947.3      707     732     example_2_RIGHT_1       2       -       TCTTCATAAGGATCAGTGCCAAGCT       gc=0.44
+```
+
+```python
+print(scheme.to_delim_str(use_header_aliases=True))
+```
+| chrom | start | end | primername | pool | strand | sequence | amplicon_prefix | amplicon_number | primer_class_str | primer_suffix | pw | fractiongc |
+|-------|-------|-----|------------|------|--------|----------|-----------------|-----------------|------------------|---------------|----|----|
+| MN908947.3 | 100 | 131 | example_1_LEFT_1 | 1 | + | CTCTTGTAGATCTGTTCTCTAAACGAACTTT | example | 1 | LEFT | 1 | 1.4 | 0.35 |
+| MN908947.3 | 419 | 447 | example_1_RIGHT_1 | 1 | - | AAAACGCCTTTTTCAACTTCTACTAAGC | example | 1 | RIGHT | 1 | 1.4 | 0.36 |
+| MN908947.3 | 344 | 366 | example_2_LEFT_1 | 2 | + | TCGTACGTGGCTTTGGAGACTC | example | 2 | LEFT | 1 | 1.0 | 0.55 |
+| MN908947.3 | 707 | 732 | example_2_RIGHT_1 | 2 | - | TCTTCATAAGGATCAGTGCCAAGCT | example | 2 | RIGHT | 1 |  | 0.44 |
+
+Key points:
+
+- The table has consistent shape (an empty `pw` was added for `example_2_RIGHT_1`)
+
+- Header line has been written with all the primer attributes parsed into columns 
+
+- Using `use_header_aliases=True` means that `gc` has been parsed into `fractiongc` due to the `# gc=fractiongc` comment line

primalbedtools/amplicons.py

@@ -1,6 +1,6 @@
 from typing import Optional
 
-from primalbedtools.bedfiles import BedLine, PrimerClass, group_amplicons
+from primalbedtools.bedfiles import BedLine, BedLineParser, PrimerClass, group_amplicons
 
 
 class Amplicon:
@@ -87,32 +87,39 @@ def __init__(
         chroms = set([bedline.chrom for bedline in all_lines])
         if len(chroms) != 1:
             raise ValueError(
-                f"All bedlines must be on the same chromosome ({','.join(chroms)})"
+                f"Failed to create amplicon as provided bedlines are on different chromosomes ({','.join(map(str, chroms))}):\n\n"
+                + BedLineParser.to_str(bedlines=all_lines, headers=None)
             )
         self.chrom = chroms.pop()
-        # Check all pools are the same
-        pools = set([bedline.pool for bedline in all_lines])
-        if len(pools) != 1:
-            raise ValueError(
-                f"All bedlines must be in the same pool ({','.join(map(str, pools))})"
-            )
-        self.pool = pools.pop()
+
         # Check all amplicon numbers are the same
         amplicon_numbers = set([bedline.amplicon_number for bedline in all_lines])
         if len(amplicon_numbers) != 1:
             raise ValueError(
-                f"All bedlines must be the same amplicon ({','.join(map(str, amplicon_numbers))})"
+                f"Failed to create amplicon as provided bedlines have different amplicon numbers ({','.join(map(str, amplicon_numbers))}):\n\n"
+                + BedLineParser.to_str(bedlines=all_lines, headers=None)
             )
         self.amplicon_number = amplicon_numbers.pop()
 
+        # Check all pools are the same
+        pools = set([bedline.pool for bedline in all_lines])
+        if len(pools) != 1:
+            raise ValueError(
+                f"Failed to create amplicon ({self.prefix}_{self.amplicon_number}) as provided bedlines have different pools ({','.join(map(str, pools))}):\n\n"
+                + BedLineParser.to_str(bedlines=all_lines, headers=None)
+            )
+        self.pool = pools.pop()
+
         # Check both forward and reverse primers are present
         if not self.left:
             raise ValueError(
-                f"No forward primers found for {self.prefix}_{self.amplicon_number}"
+                f"Failed to create amplicon ({self.prefix}_{self.amplicon_number}) as no forward primers found:\n\n"
+                + BedLineParser.to_str(bedlines=all_lines, headers=None)
             )
         if not self.right:
             raise ValueError(
-                f"No reverse primers found for {self.prefix}_{self.amplicon_number}"
+                f"Failed to create amplicon ({self.prefix}_{self.amplicon_number}) as no reverse primers found:\n\n"
+                + BedLineParser.to_str(bedlines=all_lines, headers=None)
             )
 
     def __lt__(self, other):