Skip to content
Open
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
31 changes: 28 additions & 3 deletions scadnano/scadnano.py
Original file line number Diff line number Diff line change
Expand Up @@ -3283,6 +3283,31 @@ def __eq__(self, other: Any) -> bool: # remove quotes when Py3.6 support droppe
return False
return self.domains == other.domains

def equiv(self, other: Any) -> bool:
"""
Determines whether this strand could be a copy of `other`, up to the currently
defined sequences for each. This method does not require that the names, domain names,
labels, colors, etc. be the same.
"""
if not isinstance(other, Strand):
return False
elif self.modification_3p != other.modification_3p:
return False
elif self.modification_5p != other.modification_5p:
return False
elif self.modifications_int != other.modifications_int:
return False
elif self.circular != other.circular:
return False
if len(self.domains) != len(other.domains):
return False
for d1, d2 in zip(self.domains, other.domains):
if d1.dna_sequence != d2.dna_sequence:
return False
if d1.dna_length() != d2.dna_length():
return False
return True

def __hash__(self) -> int:
return hash(self.domains)

Expand Down Expand Up @@ -7686,9 +7711,9 @@ def _assign_default_helices_view_orders_to_groups(self) -> None:
def _warn_if_strand_names_not_unique(self) -> None:
names = [strand.name for strand in self.strands if strand.name is not None]
if len(names) > len(set(names)):
for name1, name2 in itertools.combinations(names, 2):
if name1 == name2:
print(f'WARNING: there are two strands with name {name1}')
for strand1, strand2 in itertools.combinations(self.strands, 2):
if (strand1.name == strand2.name) and not strand1.equiv(strand2):
print(f'WARNING: there are two non-equivalent strands with name {strand1.name}.')

def strand_with_name(self, name: str) -> Optional[Strand]:
"""
Expand Down
47 changes: 47 additions & 0 deletions tests/scadnano_tests.py
Original file line number Diff line number Diff line change
Expand Up @@ -4078,6 +4078,53 @@ def test_JSON_bad_no_groups_but_helices_reference_groups(self) -> None:
with self.assertRaises(sc.IllegalDesignError):
sc.Design.from_scadnano_json_str(json_str)

class TestDuplicates(unittest.TestCase):
def test_warn_duplicate(self) -> None:
import contextlib
import io

# Same name, but all equivalent:
out = io.StringIO()
helices = [sc.Helix(max_offset=30) for _ in range(10)]
des = sc.Design(helices = helices, grid=sc.square)
des.draw_strand(0, 0).to(10).cross(1,9).to(-1).with_name("strand_ name!")
des.draw_strand(2, 1).to(11).to(21).with_name("strand_ name!")
des.draw_strand(3, 22).to(12).to(2).with_name("strand_ name!")
with contextlib.redirect_stdout(out):
des._warn_if_strand_names_not_unique()
self.assertNotRegex(out.getvalue(), "WARNING: there are two ")

# One sequence assigned, one not (should warn):
out = io.StringIO()
helices = [sc.Helix(max_offset=30) for _ in range(10)]
des = sc.Design(helices = helices, grid=sc.square)
des.draw_strand(2, 1).to(11).to(21).with_name("strand_ name!")
des.draw_strand(3, 22).to(12).to(2).with_name("strand_ name!").with_sequence("GTCCGTAGAGGCTACTGTCT")
with contextlib.redirect_stdout(out):
des._warn_if_strand_names_not_unique()
self.assertRegex(out.getvalue(), "WARNING: there are two non-equivalent strands with name strand_ name!")

# One more domain:
out = io.StringIO()
helices = [sc.Helix(max_offset=30) for _ in range(10)]
des = sc.Design(helices = helices, grid=sc.square)
des.draw_strand(2, 1).to(11).to(21).to(30).with_name("strand_ name!")
des.draw_strand(3, 22).to(12).to(2).with_name("strand_ name!")
with contextlib.redirect_stdout(out):
des._warn_if_strand_names_not_unique()
self.assertRegex(out.getvalue(), "WARNING: there are two non-equivalent strands with name strand_ name!")

# Modification:
biotin_5p = sc.Modification5Prime(display_text='B', idt_text='/5Biosg/')
out = io.StringIO()
helices = [sc.Helix(max_offset=30) for _ in range(10)]
des = sc.Design(helices = helices, grid=sc.square)
des.draw_strand(2, 1).to(11).to(21).to(30).with_name("strand_ name!").with_modification_5p(biotin_5p)
des.draw_strand(3, 22).to(12).to(2).with_name("strand_ name!")
with contextlib.redirect_stdout(out):
des._warn_if_strand_names_not_unique()
self.assertRegex(out.getvalue(), "WARNING: there are two non-equivalent strands with name strand_ name!")


class TestNames(unittest.TestCase):

Expand Down