make MAXK=31 NUM_COLS=1 cortex_var

[EmilyWesel]

As instructed in #0 of the README in example, I used the commands make clean and make MAXK=31 NUM_COLS=1 cortex_var.

I received the error:
collect2: ld returned 1 exit status
make: *** [cortex_var] Error 1

I'm on a Mac.

[iqbal-lab]

Hi there, can I ask which version of Cortex you are using? Where did you get it from?

[EmilyWesel]

I'm using CORTEX_release_v1.0.5.21. I got it from https://sourceforge.net/projects/cortexassembler/?source=typ_redirect

[iqbal-lab]

Can you try using git clone with this repo, and see if that fixes it?
Am also going to make a singularity container (I guess I should do docker too) too make this easier for people

[EmilyWesel]

Hi,

I used git clone and got the tool installed and running! Thank you for your help. However, when I run the tool, the output is only one file, bubbles_called_from_genome, with the following contents:

var_1_5p_flank length:276 INFO:KMER=31
ACTAGCAATGAATATGCTGAGTCACTGCATATACATACTCACAACTTTATTCTATAATGTAATATTCTATAAAGTAGCTGTATCAGTTTATACTTTAACCAGTAATGGACAAGATTTTCTATTACTTCCCATCTTTGTTATTACTTTTAGACTCTAACTTTTATCAGGCTCATGGATGTAAAAAGCATCTCAGGGTGGTTTTAATTTGCATTTATCTGCTCATCTATGAAGATGAGCTTCTTTTCATATAATTATGAGTCATTATTTTTGTTTTGC
var_1_branch_1 length:32 kmer:31
ATTCTTTTGTTTATGCATTTTGCTTGTTCTAT
var_1_branch_2 length:32 kmer:31
CTTCTTTTGTTTATGCATTTTGCTTGTTCTAT
var_1_3p_flank length:352 kmer:31
GTCTTATTTTTCCTGTTGATTTTTGGGAGTTCATATATATTCTAAATGTATATTTATTCACTTATATATATGTTGTAAATATTACAGTTTATGATTTGTCACCTTATGATATCTTCCAAATAGAGAAGCTTTATATTTTGATGTAGTCATATGTTCATTTTTCCTCCTTAATGTTTGTTTTTCTTGGTTCTATGACCTACCAAAAGTAACAAAAATTCTCATTTATTTTTAATCTAAATGTTTTAAGTATTTTCCTGGAATTCACCTTGAATTGATTTCTATTGGAGATAGGTATCCAATCTAATTTGCCTCATATGGATAACCACTTGTTCTATTACTGCTGTAACAAATT

The manual advertises three output files that detail the structural variants in the input fasta files. How can I get these three files as my output?

Thanks,
Emily

[iqbal-lab]

Hi Emily
Can you give the command line you ran and copy the text which describes these 3 files?
The output you show is the raw output of the bubble caller. Usually people use the run_calls wrapper script that takes you all the way to vcf files. Is vcf what you want?
I'm actually on vacation fir the next 2 weeks, will reply when I can