plexus is a Python-based bioinformatics tool designed to automate the creation of multiplex PCR panels. It specifically targets workflows like personalised ctDNA panels, integrating genomic data processing, primer design (via primer3), and specificity checking (via BLAST) to generate optimised primer sets for multiple targets simultaneously.
- Automated Primer Design: Uses a custom k-mer enumeration algorithm (
plexus) to generate primer candidates for each junction;primer3-pyis used for thermodynamic filtering (hairpin/self-dimer ΔG, 3′-end stability). - SNP Checking: Filters primer candidates that overlap common variants in gnomAD (or a user-supplied VCF). Supports strict mode (
--snp-strict) to discard any SNP-overlapping pair. AF-based penalty scaling is configurable. - Multiplex Optimisation: Selects the optimal primer combination minimising cross-dimer potential. Five algorithms available: Greedy (default), Random, BruteForce, SimulatedAnnealing, DFS.
- Specificity Checking: Integrates BLAST to check for off-target amplification and primer specificity.
- Multi-Panel Support: Designs multiple independent panels from a single input CSV using a
Panelcolumn (e.g., for multiple patients). Use--parallelto run panels concurrently. - Configuration Presets: Includes
defaultandlenientconfiguration presets for different design stringencies. - CLI Interface: Easy-to-use command line interface (
plexus run,plexus init,plexus status,plexus template,plexus docker). - Compliance / Clinical Mode: Stateless container-ready operation —
PLEXUS_MODE=complianceenv var, bundled tool-version manifest, on-the-fly checksum verification (--checksums), and fail-fast environment validation before any data is touched.
-
Panel Size:
plexusis specifically designed and optimised for small to medium-sized panels (typically <100 targets). While it can handle larger panels, the multiplex optimisation step (especially with cross-dimer checks) may become computationally expensive as complexity grows$O(N^2)$ .
- Python 3.10–3.13
- NCBI BLAST+ (for specificity checks —
blastnmust be on$PATH) -
bcftools(for SNP checking — must be on$PATH) -
htslib(C library required bypysam)
sudo apt-get update
sudo apt-get install -y ncbi-blast+ bcftools libhts-devbrew install blast bcftools htslibThis project uses uv for package management.
git clone https://github.com/sfilges/plexus
cd plexus
uv pip install -e .You can also set up the environment using Conda:
git clone https://github.com/sfilges/plexus
cd plexus
conda env create -f environment.yml
conda activate plexus-run
pip install -e .The primary interface is the plexus CLI.
To run the complete design pipeline:
plexus run \
--input data/junctions.csv \
--fasta data/genome.fa \
--output results/ \
--name my_panelThe input file should be a CSV containing the target junctions with the following columns:
Name,Chrom,Five_Prime_Coordinate,Three_Prime_Coordinate
EGFR_T790M,chr7,55181378,55181378
KRAS_G12D,chr12,25245350,25245350
...See data/junctions.csv for a complete example. Use plexus template to generate a starter file.
If the input CSV contains a Panel column, junctions are grouped by panel value and each panel is designed independently. Results are saved to <output>/<panel_id>/.
Name,Chrom,Five_Prime_Coordinate,Three_Prime_Coordinate,Panel
EGFR_T790M,chr7,55181378,55181378,panel_a
KRAS_G12D,chr12,25245350,25245350,panel_a
TP53_R248W,chr17,7674220,7674220,panel_bUse --parallel to run panels concurrently.
plexus init registers your local reference FASTA and SNP VCF (gnomAD) so you don't need to pass --fasta on every run. Without flags it launches an interactive wizard:
plexus initTo run non-interactively:
plexus init --fasta /path/to/hg38.fa --snp-vcf /path/to/gnomad.vcf.gzCheck resource status at any time:
plexus statusTo use a custom VCF on a per-run basis (must be tabix-indexed):
plexus run -i junctions.csv -f genome.fa --snp-vcf /path/to/custom.vcf.gzUse --snp-strict to discard any primer pair that overlaps a SNP above the AF threshold (default 1%), rather than just penalising it.
| Option | Default | Description |
|---|---|---|
-i, --input |
required | Path to input CSV file |
-f, --fasta |
registered genome | Path to reference genome FASTA |
-o, --output |
./output |
Output directory |
-n, --name |
multiplex_panel |
Panel name |
-g, --genome |
hg38 |
Reference genome name |
-p, --preset |
default |
Config preset (default or lenient) |
-c, --config |
— | Path to custom JSON config file |
-s, --selector |
Greedy |
Selector algorithm: Greedy, Random, BruteForce, SimulatedAnnealing, DFS |
--selector-seed |
— | Random seed for stochastic selectors |
--skip-blast |
false | Skip BLAST specificity check |
--skip-snpcheck |
false | Skip SNP overlap check |
--snp-vcf |
registered gnomAD | Path to tabix-indexed VCF for SNP checking |
--snp-af-threshold |
0.01 |
Minimum allele frequency for SNP flagging |
--snp-strict |
false | Discard primer pairs overlapping SNPs |
--strict |
false | Verify checksums via registry before running |
--checksums |
— | SHA-256 checksums file for stateless verification (bypasses registry) |
--padding |
200 |
Bases to extract around each junction |
--parallel |
false | Run multiple panels in parallel |
--max-workers |
auto | Max parallel workers (multi-panel mode) |
--debug |
false | Write DEBUG-level messages to the log file |
Run plexus --help for a full list of commands and options.
plexus template --output ./my_project/Creates junctions.csv (with example targets) and designer_config.json (full config with all defaults) in the specified directory.
Plexus has a built-in compliance mode designed for containerised clinical or regulated environments where no persistent ~/.plexus/ workspace exists.
| Priority | Source | How to set |
|---|---|---|
| 1 (highest) | PLEXUS_MODE env var |
export PLEXUS_MODE=compliance or bake into Docker image |
| 2 | ~/.plexus/config.json |
plexus init --mode compliance |
| 3 (default) | built-in default | research |
The plexus docker command is a convenience wrapper that handles volume mounts and path translation automatically:
plexus docker \
--fasta /data/hg38.fa \
--snp-vcf /data/gnomad.vcf.gz \
--checksums /data/checksums.sha256 \
--input /data/junctions.csv \
--output /data/results/To run a specific tagged version or pass through extra plexus run flags:
plexus docker --tag 1.0.0 \
--fasta /data/hg38.fa \
--input /data/junctions.csv \
--output /data/results/ \
--skip-blastTo run the Docker image directly (without the plexus docker wrapper):
docker run \
-v /data/hg38.fa:/mnt/hg38.fa \
-v /data/gnomad.vcf.gz:/mnt/gnomad.vcf.gz \
-v /data/checksums.sha256:/mnt/checksums.sha256 \
-v /data/junctions.csv:/mnt/junctions.csv \
-v /data/output:/mnt/output \
ghcr.io/sfilges/plexus:latest \
run \
--input /mnt/junctions.csv \
--fasta /mnt/hg38.fa \
--snp-vcf /mnt/gnomad.vcf.gz \
--checksums /mnt/checksums.sha256 \
--output /mnt/outputWhat happens at runtime:
PLEXUS_MODE=compliance(baked into image) — no registry consulted- CLI verifies FASTA + VCF against
checksums.sha256before the pipeline starts run_pipeline()callsvalidate_environment()— exact tool versions checked against the bundled compliance manifest — fails in <1 s if versions don't match- Pipeline runs;
provenance.jsoncontains verified checksums and acompliance_environmentverdict block
sha256sum hg38.fa gnomad.vcf.gz > checksums.sha256The file src/plexus/data/compliance_manifest.json (bundled in the package, immutable) declares the exact tool versions required. Its own version is independent of the plexus version and increments only when the required tool set changes.
{
"version": "1.1",
"tools": {
"blastn": { "exact_version": "2.17.0", ... },
"makeblastdb": { "exact_version": "2.17.0", ... },
"blast_formatter":{ "exact_version": "2.17.0", ... },
"bcftools": { "exact_version": "1.23", ... }
},
"python_packages": {
"primer3-py": { "exact_version": "2.3.0", ... },
"pysam": { "exact_version": "0.23.3", ... }
}
}In compliance mode, provenance.json includes a compliance_environment block:
{
"operational_mode": "compliance",
"fasta_sha256": "a1b2c3...",
"compliance_environment": {
"manifest_version": "1.1",
"blastn": { "expected": "2.17.0", "actual": "2.17.0", "verdict": "pass" },
"bcftools": { "expected": "1.23", "actual": "1.23", "verdict": "pass" },
"primer3-py": { "expected": "2.3.0", "actual": "2.3.0", "verdict": "pass" },
"pysam": { "expected": "0.23.3", "actual": "0.23.3", "verdict": "pass" }
}
}See docs/COMPLIANCE_GUIDE.md for the full compliance workflow including local (registry-based) and stateless (container) paths.
Design parameters are controlled via JSON config files. Use --config to supply your own, or --preset to choose a built-in starting point (default or lenient).
Partial configs are fully supported — you only need to include the parameters you want to change. Any omitted parameter falls back to the preset default.
The config is divided into five sections:
| Section | Controls |
|---|---|
singleplex_design_parameters |
Primer length (18–28 bp), Tm (57–63 °C), GC%, thermodynamic thresholds, adapter tail sequences |
primer_pair_parameters |
Amplicon size, Tm difference, pair penalty weights |
pcr_conditions |
Salt concentrations, annealing temperature, thermodynamic tables |
snp_check_parameters |
AF threshold, SNP penalty weight, 3′-window multiplier, strict mode |
multiplex_picker_parameters |
Optimisation weights (cross-dimer, off-target, SNP penalty), selector settings |
To widen the Tm window and use a stricter cross-dimer weight, create a file such as my_config.json:
{
"singleplex_design_parameters": {
"PRIMER_MIN_TM": 55.0,
"PRIMER_MAX_TM": 66.0
},
"multiplex_picker_parameters": {
"wt_cross_dimer": 3.0
}
}Then run:
plexus run -i junctions.csv -f genome.fa --config my_config.jsonAll parameters not listed in your file are inherited from the default preset.
forward_tail and reverse_tail set the adapter sequences prepended to each primer (at the 5′ end). The defaults are SiMSen-Seq-style adapters. Override them in singleplex_design_parameters:
{
"singleplex_design_parameters": {
"forward_tail": "ACACTCTTTCCCTACACGACGCTCTTCCGATCT",
"reverse_tail": "GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT"
}
}The full ready-to-order sequences (tail + binding region) are written to the Forward_Full_Seq / Reverse_Full_Seq columns in the output CSVs. Bare binding sequences are also retained in Forward_Seq / Reverse_Seq.
Run plexus template to generate a designer_config.json containing every parameter with its default value — a useful reference when building a custom config.
For programmatic use, import run_pipeline directly:
from plexus.pipeline import run_pipeline
result = run_pipeline(
"data/junctions.csv",
"/path/to/hg38.fa",
output_dir="./output",
panel_name="my_panel",
)
print(f"Selected {len(result.selected_pairs)} primer pairs")See docs/getting_started.ipynb for a full walkthrough including panel inspection, primer pair exploration, and output file descriptions.