Skip to content

sfilges/plexus

Repository files navigation

plexus

CI Python License: GPL v2+

plexus is a Python-based bioinformatics tool designed to automate the creation of multiplex PCR panels. It specifically targets workflows like personalised ctDNA panels, integrating genomic data processing, primer design (via primer3), and specificity checking (via BLAST) to generate optimised primer sets for multiple targets simultaneously.

Features

  • Automated Primer Design: Uses a custom k-mer enumeration algorithm (plexus) to generate primer candidates for each junction; primer3-py is used for thermodynamic filtering (hairpin/self-dimer ΔG, 3′-end stability).
  • SNP Checking: Filters primer candidates that overlap common variants in gnomAD (or a user-supplied VCF). Supports strict mode (--snp-strict) to discard any SNP-overlapping pair. AF-based penalty scaling is configurable.
  • Multiplex Optimisation: Selects the optimal primer combination minimising cross-dimer potential. Five algorithms available: Greedy (default), Random, BruteForce, SimulatedAnnealing, DFS.
  • Specificity Checking: Integrates BLAST to check for off-target amplification and primer specificity.
  • Multi-Panel Support: Designs multiple independent panels from a single input CSV using a Panel column (e.g., for multiple patients). Use --parallel to run panels concurrently.
  • Configuration Presets: Includes default and lenient configuration presets for different design stringencies.
  • CLI Interface: Easy-to-use command line interface (plexus run, plexus init, plexus status, plexus template, plexus docker).
  • Compliance / Clinical Mode: Stateless container-ready operation — PLEXUS_MODE=compliance env var, bundled tool-version manifest, on-the-fly checksum verification (--checksums), and fail-fast environment validation before any data is touched.

Limitations

  • Panel Size: plexus is specifically designed and optimised for small to medium-sized panels (typically <100 targets). While it can handle larger panels, the multiplex optimisation step (especially with cross-dimer checks) may become computationally expensive as complexity grows $O(N^2)$.

Installation

Prerequisites

  • Python 3.10–3.13
  • NCBI BLAST+ (for specificity checks — blastn must be on $PATH)
  • bcftools (for SNP checking — must be on $PATH)
  • htslib (C library required by pysam)

Debian / Ubuntu

sudo apt-get update
sudo apt-get install -y ncbi-blast+ bcftools libhts-dev

macOS (Homebrew)

brew install blast bcftools htslib

Using uv (Recommended)

This project uses uv for package management.

git clone https://github.com/sfilges/plexus
cd plexus
uv pip install -e .

Using Conda

You can also set up the environment using Conda:

git clone https://github.com/sfilges/plexus
cd plexus
conda env create -f environment.yml
conda activate plexus-run
pip install -e .

Usage

The primary interface is the plexus CLI.

Basic Command

To run the complete design pipeline:

plexus run \
  --input data/junctions.csv \
  --fasta data/genome.fa \
  --output results/ \
  --name my_panel

Input file format

The input file should be a CSV containing the target junctions with the following columns:

Name,Chrom,Five_Prime_Coordinate,Three_Prime_Coordinate
EGFR_T790M,chr7,55181378,55181378
KRAS_G12D,chr12,25245350,25245350
...

See data/junctions.csv for a complete example. Use plexus template to generate a starter file.

Multi-Panel Input

If the input CSV contains a Panel column, junctions are grouped by panel value and each panel is designed independently. Results are saved to <output>/<panel_id>/.

Name,Chrom,Five_Prime_Coordinate,Three_Prime_Coordinate,Panel
EGFR_T790M,chr7,55181378,55181378,panel_a
KRAS_G12D,chr12,25245350,25245350,panel_a
TP53_R248W,chr17,7674220,7674220,panel_b

Use --parallel to run panels concurrently.

Initialising resources

plexus init registers your local reference FASTA and SNP VCF (gnomAD) so you don't need to pass --fasta on every run. Without flags it launches an interactive wizard:

plexus init

To run non-interactively:

plexus init --fasta /path/to/hg38.fa --snp-vcf /path/to/gnomad.vcf.gz

Check resource status at any time:

plexus status

To use a custom VCF on a per-run basis (must be tabix-indexed):

plexus run -i junctions.csv -f genome.fa --snp-vcf /path/to/custom.vcf.gz

Use --snp-strict to discard any primer pair that overlaps a SNP above the AF threshold (default 1%), rather than just penalising it.

Key Options

Option Default Description
-i, --input required Path to input CSV file
-f, --fasta registered genome Path to reference genome FASTA
-o, --output ./output Output directory
-n, --name multiplex_panel Panel name
-g, --genome hg38 Reference genome name
-p, --preset default Config preset (default or lenient)
-c, --config Path to custom JSON config file
-s, --selector Greedy Selector algorithm: Greedy, Random, BruteForce, SimulatedAnnealing, DFS
--selector-seed Random seed for stochastic selectors
--skip-blast false Skip BLAST specificity check
--skip-snpcheck false Skip SNP overlap check
--snp-vcf registered gnomAD Path to tabix-indexed VCF for SNP checking
--snp-af-threshold 0.01 Minimum allele frequency for SNP flagging
--snp-strict false Discard primer pairs overlapping SNPs
--strict false Verify checksums via registry before running
--checksums SHA-256 checksums file for stateless verification (bypasses registry)
--padding 200 Bases to extract around each junction
--parallel false Run multiple panels in parallel
--max-workers auto Max parallel workers (multi-panel mode)
--debug false Write DEBUG-level messages to the log file

Run plexus --help for a full list of commands and options.

Generating starter files

plexus template --output ./my_project/

Creates junctions.csv (with example targets) and designer_config.json (full config with all defaults) in the specified directory.

Compliance Mode and Container Deployment

Plexus has a built-in compliance mode designed for containerised clinical or regulated environments where no persistent ~/.plexus/ workspace exists.

Operational Mode Priority

Priority Source How to set
1 (highest) PLEXUS_MODE env var export PLEXUS_MODE=compliance or bake into Docker image
2 ~/.plexus/config.json plexus init --mode compliance
3 (default) built-in default research

Stateless Container Workflow

The plexus docker command is a convenience wrapper that handles volume mounts and path translation automatically:

plexus docker \
  --fasta /data/hg38.fa \
  --snp-vcf /data/gnomad.vcf.gz \
  --checksums /data/checksums.sha256 \
  --input /data/junctions.csv \
  --output /data/results/

To run a specific tagged version or pass through extra plexus run flags:

plexus docker --tag 1.0.0 \
  --fasta /data/hg38.fa \
  --input /data/junctions.csv \
  --output /data/results/ \
  --skip-blast

To run the Docker image directly (without the plexus docker wrapper):

docker run \
  -v /data/hg38.fa:/mnt/hg38.fa \
  -v /data/gnomad.vcf.gz:/mnt/gnomad.vcf.gz \
  -v /data/checksums.sha256:/mnt/checksums.sha256 \
  -v /data/junctions.csv:/mnt/junctions.csv \
  -v /data/output:/mnt/output \
  ghcr.io/sfilges/plexus:latest \
  run \
    --input /mnt/junctions.csv \
    --fasta /mnt/hg38.fa \
    --snp-vcf /mnt/gnomad.vcf.gz \
    --checksums /mnt/checksums.sha256 \
    --output /mnt/output

What happens at runtime:

  1. PLEXUS_MODE=compliance (baked into image) — no registry consulted
  2. CLI verifies FASTA + VCF against checksums.sha256 before the pipeline starts
  3. run_pipeline() calls validate_environment() — exact tool versions checked against the bundled compliance manifest — fails in <1 s if versions don't match
  4. Pipeline runs; provenance.json contains verified checksums and a compliance_environment verdict block

Generating a Checksums File

sha256sum hg38.fa gnomad.vcf.gz > checksums.sha256

What the Compliance Manifest Enforces

The file src/plexus/data/compliance_manifest.json (bundled in the package, immutable) declares the exact tool versions required. Its own version is independent of the plexus version and increments only when the required tool set changes.

{
  "version": "1.1",
  "tools": {
    "blastn":         { "exact_version": "2.17.0", ... },
    "makeblastdb":    { "exact_version": "2.17.0", ... },
    "blast_formatter":{ "exact_version": "2.17.0", ... },
    "bcftools":       { "exact_version": "1.23",   ... }
  },
  "python_packages": {
    "primer3-py":     { "exact_version": "2.3.0",  ... },
    "pysam":          { "exact_version": "0.23.3", ... }
  }
}

Compliance Provenance Record

In compliance mode, provenance.json includes a compliance_environment block:

{
  "operational_mode": "compliance",
  "fasta_sha256": "a1b2c3...",
  "compliance_environment": {
    "manifest_version": "1.1",
    "blastn":      { "expected": "2.17.0", "actual": "2.17.0", "verdict": "pass" },
    "bcftools":    { "expected": "1.23",   "actual": "1.23",   "verdict": "pass" },
    "primer3-py":  { "expected": "2.3.0",  "actual": "2.3.0",  "verdict": "pass" },
    "pysam":       { "expected": "0.23.3", "actual": "0.23.3", "verdict": "pass" }
  }
}

See docs/COMPLIANCE_GUIDE.md for the full compliance workflow including local (registry-based) and stateless (container) paths.

Configuration

Design parameters are controlled via JSON config files. Use --config to supply your own, or --preset to choose a built-in starting point (default or lenient).

Partial configs are fully supported — you only need to include the parameters you want to change. Any omitted parameter falls back to the preset default.

Config file structure

The config is divided into five sections:

Section Controls
singleplex_design_parameters Primer length (18–28 bp), Tm (57–63 °C), GC%, thermodynamic thresholds, adapter tail sequences
primer_pair_parameters Amplicon size, Tm difference, pair penalty weights
pcr_conditions Salt concentrations, annealing temperature, thermodynamic tables
snp_check_parameters AF threshold, SNP penalty weight, 3′-window multiplier, strict mode
multiplex_picker_parameters Optimisation weights (cross-dimer, off-target, SNP penalty), selector settings

Minimal override example

To widen the Tm window and use a stricter cross-dimer weight, create a file such as my_config.json:

{
    "singleplex_design_parameters": {
        "PRIMER_MIN_TM": 55.0,
        "PRIMER_MAX_TM": 66.0
    },
    "multiplex_picker_parameters": {
        "wt_cross_dimer": 3.0
    }
}

Then run:

plexus run -i junctions.csv -f genome.fa --config my_config.json

All parameters not listed in your file are inherited from the default preset.

Adapter tail sequences

forward_tail and reverse_tail set the adapter sequences prepended to each primer (at the 5′ end). The defaults are SiMSen-Seq-style adapters. Override them in singleplex_design_parameters:

{
    "singleplex_design_parameters": {
        "forward_tail": "ACACTCTTTCCCTACACGACGCTCTTCCGATCT",
        "reverse_tail": "GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT"
    }
}

The full ready-to-order sequences (tail + binding region) are written to the Forward_Full_Seq / Reverse_Full_Seq columns in the output CSVs. Bare binding sequences are also retained in Forward_Seq / Reverse_Seq.

Viewing all available parameters

Run plexus template to generate a designer_config.json containing every parameter with its default value — a useful reference when building a custom config.

Python API

For programmatic use, import run_pipeline directly:

from plexus.pipeline import run_pipeline

result = run_pipeline(
    "data/junctions.csv",
    "/path/to/hg38.fa",
    output_dir="./output",
    panel_name="my_panel",
)

print(f"Selected {len(result.selected_pairs)} primer pairs")

See docs/getting_started.ipynb for a full walkthrough including panel inspection, primer pair exploration, and output file descriptions.

About

Multiplex primer design for targeted amplicon sequencing

Topics

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors